-
Články
Top novinky
Reklama- Vzdělávání
- Časopisy
Top články
Nové číslo
- Témata
Top novinky
Reklama- Videa
- Podcasty
Nové podcasty
Reklama- Práce v oboru
Doporučené pozice
Reklama- Praktické
Top novinky
ReklamaTemperature regulates synaptic subcellular specificity mediated by inhibitory glutamate signaling
Authors: Mengqing Wang aff001; Daniel Witvliet aff002; Mengting Wu aff001; Lijun Kang aff004; Zhiyong Shao aff001
Authors place of work: Department of Neurosurgery, State Key Laboratory of Medical Neurobiology and MOE Frontiers Center for Brain Science, Institutes of Brain Science, Zhongshan Hospital, Fudan University, Shanghai, China aff001; Lunenfeld-Tanenbaum Research Institute, Mount Sinai Hospital, Toronto, Ontario, Canada aff002; Department of Molecular Genetics, University of Toronto, Toronto, Ontario, Canada aff003; Department of Neurobiology and Department of Neurosurgery of the First Affiliated Hospital, Zhejiang University School of Medicine, Hangzhou, Zhejiang, China aff004
Published in the journal: Temperature regulates synaptic subcellular specificity mediated by inhibitory glutamate signaling. PLoS Genet 17(1): e1009295. doi:10.1371/journal.pgen.1009295
Category: Research Article
doi: https://doi.org/10.1371/journal.pgen.1009295Summary
Environmental factors such as temperature affect neuronal activity and development. However, it remains unknown whether and how they affect synaptic subcellular specificity. Here, using the nematode Caenorhabditis elegans AIY interneurons as a model, we found that high cultivation temperature robustly induces defects in synaptic subcellular specificity through glutamatergic neurotransmission. Furthermore, we determined that the functional glutamate is mainly released by the ASH sensory neurons and sensed by two conserved inhibitory glutamate-gated chloride channels GLC-3 and GLC-4 in AIY. Our work not only presents a novel neurotransmission-dependent mechanism underlying the synaptic subcellular specificity, but also provides a potential mechanistic insight into high-temperature-induced neurological defects.
Keywords:
Genetically modified animals – Glutamate – Chlorides – Interneurons – Neurons – Synapses – Test statistics
Introduction
Normal brain functions require precise synaptic connectivity among billions of neuronal and non-neuronal cells. Synaptic targeting happens not only at the cellular, but also at the subcellular level [1–3]. For example, in mouse cerebellum, basket neurons specifically form synapses at the axon initial segment of purkinje neurons [4]. Similarly, C. elegans specific AIY presynaptic region targets onto the RIA interneurons [5,6]. In the last couple of decades, studies have identified many genetic factors required for synaptic subcellular specificity, including secreted and adhesion molecules [4,6–16]. Additionally, synaptic development is also regulated by neural activity [17–19]. However, it is largely unknown whether environmental-dependent neuronal activity is involved in the synaptic subcellular specificity.
Temperature is a special environmental factor that can affect neuronal development and functions through activity-dependent manner [20–25]. Neuronal activity plays critical roles in neural circuitry development [18,19]. In vertebrates, neuronal activity is essential for synapse formation in the visual system [26–28]. In invertebrates, neural circuitry was traditionally thought to be hardwired and regulated by activity-independent mechanisms [29–34]. However, recent studies show that neural activity is involved in the circuit development and remodeling in Drosophila [35–38]. Similarly, in C. elegans, neuronal activity can modulate neurite growth and branching [39–42], cell fate determination [43], presynaptic remodeling and dendritic spine density [44,45]. However, it is unknown whether and how temperature or neuronal activity affects the synaptic subcellular specificity.
The nematode C. elegans AIY interneurons are part of the thermotaxis circuit [46–51]. In this circuit, sensory neurons such as AFD and AWC sense the thermal information and transmit it to the AIY interneurons through glutamatergic synapses [46,51–54]. The information is further passed from AIY to the next layer interneurons including RIA and AIZ [46,51]. Although the thermotaxis circuit is known for a long time, the detailed circuit connectivity is not completely understood, and the regulatory mechanisms underlying the circuit formation are largely unknown.
AIY forms stereotypic presynaptic distribution [5,6]. With this system, we previously found that the epithelial CIMA-1, a sialic acid transmembrane transporter, is required for maintaining the subcellular specificity of the AIY interneurons. In cima-1 loss-of-function mutants, ectopic synapses emerge in the AIY asynaptic region partially due to the posterior displacement of ventral cephalic sheath cells (VCSC) glial endfeet [55]. However, ablating the VCSC glia did not completely suppress the cima-1 ectopic synapses, suggesting that additional signals, most likely from the nervous system, are involved [55].
In this study, we showed that the AIY ectopic synaptic formation in cima-1 loss-of-function mutants requires the inhibitory glutamate signaling, which is mediated by the ASH expressed vesicular glutamate transporter EAT-4 and the AIY expressed pLGIC family glutamate gated chloride channels GLC-3 and GLC-4. Additionally, we showed that wild-type animals cultivated at high temperature display ectopic AIY presynaptic phenotype mimicking the cima-1 mutants. The glutamate transporter EAT-4 in ASH and the glutamate gated chloride channels GLC-3 and GLC-4 in AIY are required for both cima-1 and high-temperature-induced ectopic synapse formation in AIY neurons. Our study not only uncovers a novel role of the glutamatergic transmission in synaptic subcellular specificity, but also provides potential pathological insights into the high temperature-induced neurodevelopmental defects.
Results
Glutamatergic neurotransmission regulates the AIY presynaptic subcellular specificity
The C. elegans AIY neurons are a pair of bilaterally symmetric neurons in the head with stereotypical synaptic distribution: the ventral asynaptic zone 1 region, the synaptic-enriched zone 2 region, and the distal synaptic-scattered zone 3 region [5,6] (Fig 1A). The sialin homolog CIMA-1 in epidermal cells and the ADAMTS metalloprotease MIG-17 in muscles are required to maintain AIY presynaptic subcellular specificity mediated by the VCSC glia morphology during adult stage [55,56]. Incomplete suppression of the cima-1(wy84) ectopic synapses by VCSC glia ablation implies that neuronal signaling is involved in the synaptic subcellular specificity (see the model in Fig 1A and [55]).
Fig. 1. Glutamatergic neurotransmission is required for the AIY ectopic synaptic formation in cima-1(wy84). Neuronal activity plays important roles in circuit formation [18,19]. To determine if the ectopic AIY presynaptic phenotype requires neuronal activity, we used synaptic transmission defects unc-13(e1091) mutants [57]. We found that unc-13(e1091) mutants displayed normal AIY presynaptic distribution (S1A–S1C and S1J Fig), consistent with previous findings that synaptic transmission is not required for normal synaptic formation [31,33,34].
Next, we asked if neurotransmission was required for the ectopic synaptic formation in cima-1(wy84) mutants. To address the question, we made cima-1(wy84);unc-13(e1091) double mutants, and found that unc-13(e1091) robustly suppressed the ectopic synapses in cima-1(wy84) mutants (90.19% of animals displayed ectopic synapses in cima-1(wy84) vs 23.38% in cima-1(wy84);unc-13(e1091) mutants, p<0.0001, Fig 1C–1E and 1O). Those data indicate that neurotransmission is required for the ectopic synapse formation in the cima-1(wy84) mutants.
To determine which type of neurotransmission is required, we blocked the glutamatergic, GABAergic, cholinergic, or dopaminergic neurotransmission via the following loss-of-function mutants: eat-4, unc-47, unc-17 and cat-2, which encode the vesicle glutamate transporter, vesicle gamma-aminobutyric acid γ (GABA) transporter, acetylcholine transmembrane transporter and dopamine biosynthetic enzyme respectively [58–61]. Consistent with that seen in unc-13(e1091) mutants, the AIY synaptic distribution was normal in those single mutants (S1C–S1J Fig), suggesting that those types of neurotransmission are not required for synaptic spatial specificity per se. Then, we tested their roles in the ectopic synaptic formation in cima-1(wy84) mutants. We found that the ectopic synapses were robustly suppressed only by eat-4(ky5) as assayed with both synaptic vesicle marker GFP::RAB-3 (90.19% of animals with ectopic synapses in cima-1(wy84) and 20.98% in cima-1(wy84);eat-4(ky5), p<0.0001. Fig 1F and 1O), and the synaptic active zone marker GFP::SYD-1 (Fig 1L–1O), but not by unc-47(n2409), unc-17(cn355), or cat-2(e1112) mutations (S2A–S2E Fig). The effect of eat-4(ky5) on suppressing the cima-1(wy84) ectopic synapses was validated with two additional loss-of-function eat-4(nj2) and eat-4(nj6) alleles [51] (Fig 1G, 1H and 1O). To exclude the possibility that the suppression of the cima-1 ectopic synapses is wy84 allele-specific, we tested another independently isolated cima-1 allele gk902655 that harbors a nonsense mutation at the R476 site [55,62]. Consistent with the cima-1(wy84) data, we found that both unc-13(e1091) and eat-4(ky5) suppressed the AIY presynaptic specificity defects induced by cima-1(gk902655) (72.65%, 9.37% and 12.11% of animals displayed ectopic synapses in cima-1(gk902655), cima-1(gk902655);unc-13(e1091) and cima-1(gk902655);eat-4(ky5) respectively, p<0.0001 for both comparison, Fig 1I–1K and 1O). These data suggest that the suppression of the ectopic synapses is not wy84 allele specific.
To further confirm the requirement of eat-4 for the AIY synaptic phenotype in cima-1 mutants, we quantified the expressivity of the ectopic synapses by measuring the ventral synaptic length and the ratio of the ventral to total synaptic length. In the cima-1(wy84) mutants, the ventral synaptic length and the ratio of the ventral to total synaptic length increased dramatically due to the formation of ectopic synapses (the length and the ratio are 8.65μm and 0.21 in WT; vs 16.68μm and 0.33 in the cima-1(wy84) mutants, P<0.0001. Fig 1M and 1N). Consistent with the penetrance data described above, both the ventral synaptic length and the ratio in cima-1(wy84) mutants were significantly suppressed by eat-4(ky5) (the length and the ratio are 16.68μm and 0.33 in cima-1(wy84); vs 9.38μm and 0.23 in the cima-1(wy84);eat-4(ky5) double mutants, P<0.0001. Fig 1P and 1Q).
Collectively, these data indicate that glutamatergic neurotransmission is required for the ectopic synaptic formation in cima-1(wy84) mutants.
eat-4 acts in the ASH neurons to regulate the AIY synaptic subcellular specificity
To understand where eat-4 acts to regulate the AIY synaptic subcellular specificity, we performed tissue-specific rescue by expressing eat-4 cDNA in different tissues or cell types. We found that eat-4 completely rescued and restored the ectopic synapses in cima-1(wy84);eat-4(ky5) double mutants when expressed in the nervous system with rab-3 promoter [63], or in the glutamatergic neurons with eat-4a promoter (S3A Fig, [64]), but not in the VCSC glia, epidermis, muscle, intestine or AIY interneurons with hlh-17, dpy-7, myo-3, ges-1 and ttx-3 promoters respectively [65–69] (Fig 2A and 2B). The data further support the hypothesis that glutamatergic neurotransmission is required for the ectopic synapse formation in cima-1(wy84) mutants.
Fig. 2. eat-4 acts mainly in the ASH to regulate the AIY synaptic subcellular specificity. (A) The tested tissue-specific promoters (first row) and the tissues/neurons were listed in the table. Green boxes indicate the expressing tissues/neurons, while the empty boxes indicate the non-expressing ones. Note that the neurons expressing eat-4 cDNA through eat-4a or rab-3 promoter include but are not limited to those listed in the table. (B-D) Quantification of the percentage of animals with the ectopic AIY synaptic GFP::RAB-3 in the zone 1 region for tissue-specific rescue (B), tissue-specific overexpression (C) and ASH ablation (D) for the indicated genotypes. The data in (B) collectively demonstrate that eat-4 expressed in the ASH neurons contributes to the major portion of the animals with the ectopic synapses. The data in (C) show that eat-4 overexpression in the ASH is sufficient to induce the ectopic synapses in the AIY zone 1 region. The data in (D) showed that ASH is required for the ectopic synaptic formation in cima-1(wy84) or ASH-specific eat-4(OE) (Psra-6::EAT-4) animals. Error bars are SEM. *P< 0.05, ****P< 0.0001, n.s., not significant. Statistics are based on one-way ANOVA with Dunnett’s test (B, C) or unpaired t test (D). The total number of independent animals (N) and the number of biological replicates (n1) are indicated in each bar for each genotype, as are, for the transgenic lines created, the number of independent transgenic lines (n2) examined (using the convention N/n1 or N/n1/n2). To further determine the specific glutamatergic neuron(s) involved in the AIY ectopic synaptic formation in cima-1(wy84) mutants, we expressed eat-4 cDNA in the glutamatergic neurons previously identified as AIY synaptic partners including the presynaptic AUA (Pflp-8)[70], ASE (Pgcy-5)[71], AFD (Pgcy-8)[71], AWC (Pstr-2)[72], ASG and BAG (Peat-4b: 4454bp to 3554bp upstream regulatory sequence) [64] and the postsynaptic RIA (Pglr-3) neurons [5,73]. To our surprise, none of them rescued (Fig 2A and 2B). Then, we expressed eat-4 in twelve pairs of sensory neurons, including AWC, ASG, ASH, ASK, ADL, PHA and PHB seven pairs of glutamatergic neurons with odr-4 promoter [74]. Interestingly, this transgene fully rescued (Fig 2A and 2B). Finally, we tested the rescue in ASH, ASK or ADL with nhr-79 (or sra-6), sra-9 and srh-220 promoter respectively [75–78], but not in others because AWC and ASG were excluded previously and PHA and PHB are located in the tail, far away from AIY neurons. Interestingly, robust rescue was observed when eat-4 was expressed in the ASH, and to a less degree in ASK, but not in ADL neurons (Fig 2A and 2B). The data suggest that eat-4 acts mainly in the ASH to promote the AIY ectopic synapse formation in cima-1(wy84) mutants.
VGLUT overexpression leads to increasing glutamate loading in the synaptic vesicle and enhancing glutamate release in Drosophila [79,80] and vertebrates [81,82]. To determine whether overexpression of EAT-4/VGLUT is sufficient to induce the AIY ectopic synapses, we overexpressed the eat-4 cDNA in the ASH with different promoters, and found that they all robustly induced the ectopic synapses (Fig 2C). The data suggest that eat-4(OE) in the ASH is sufficient to induce the AIY ectopic synapse formation.
To further confirm the role of ASH neurons in regulating AIY synaptic specificity, we ablated the ASH neurons by expressing apoptotic protein caspase-3 [83]. We observed that ASH ablation partially but significantly suppressed the ectopic synapses induced by cima-1(wy84) (89.91% and 53.94% of animals with ectopic synapses in ASH-normal and -ablated animals respectively, p<0.0001. Fig 2D), and completely abolished the ectopic synapses induced by eat-4 overexpression in the ASH (43.97% and 14.09% of animals with ectopic synapses in ASH-normal and -ablated animals respectively, p<0.0001. Fig 2D). Those data further support that the glutamate required for the AIY ectopic synaptic formation is mainly from the ASH sensory neurons.
CIMA-1 regulates the AIY synaptic position mediated partially through VCSC glia [55,56]. To address if the VCSC glia is required for the glutamatergic signaling induced ectopic synapse formation, we ablated the VCSC glia in wild-type, cima-1(wy84) and eat-4(OE) animals. In wild-type animals, loss of the glia did not affect synaptic distribution (18.31% and 15.75% of total animals with ectopic synapses in wild type and glia-ablated animals respectively, p = 0.4788. S4A Fig). In cima-1(wy84) mutants, glia ablation partially suppressed the ectopic synaptic distribution (93.11% and 66.08% of total animals with ectopic synapses in glia-normal and -ablated animals respectively, p = 0.0023. S4A Fig), which is consistent with previous studies [55]. Interestingly, in eat-4(OE) (Peat-4a::EAT-4 transgenic) animals, glia ablation only slightly suppressed the ectopic synapses (62.19% and 53.37% of total animals with ectopic synapses in glia normal and ablated animals, p = 0.0047. S4A Fig). The data indicated that VCSC glia only contribute a little to the synaptic defect induced by eat-4(OE). In other words, eat-4(OE) promotes the AIY ectopic synaptic formation largely in a glia-independent manner.
To address when eat-4 acts, we quantified the AIY synaptic distribution at different developmental stages in eat-4(OE) animals. Interestingly, the ectopic synapses in eat-4(OE) emerged since the larval L1 stage (S5A–S5I Fig), unlike in cima-1(wy84) mutants which shows up only at adult stage [55]. Consistently, we found that the ventral synaptic length and the ratio of ventral to total synaptic length were significantly increased since the L1 stage (S5H–S5I Fig). Furthermore, the eat-4 embryonic expression supports its early role in AIY synaptic subcellular specificity (S3B and S3B’ Fig). These data collectively indicate that eat-4(OE) and cima-1(wy84) may promote the AIY ectopic synaptic formation through different mechanisms.
The synapses in zone 2 of wild-type animals are formed primarily onto the postsynaptic partner RIA [5]. To determine whether the ectopic synapses in eat-4(OE) are targeted to RIA, we simultaneously labeled RIA neurons and the AIY presynaptic sites, and found that the AIY ectopic presynaptic sites were only partially in apposition to the RIA neurons (S5J and S5K Fig), suggesting that some of the AIY ectopic synapses are not targeting onto RIA.
Glutamate-gated chloride channels GLC-3 and GLC-4 mediate the ectopic synapse formation
To address which glutamate receptor(s) is required, we analyzed all four types of glutamate receptors that have been identified in C. elegans including AMPA receptors, NMDA receptors, metabotropic G-protein-coupled receptors and glutamate-gated chloride channels (GluCls) (Fig 3A) [84–86]. Among eighteen loss-of-function receptors we tested, all of them displayed the normal AIY synaptic subcellular distribution (S6A–S6R Fig), suggesting that those receptors are not required for the AIY presynaptic subcellular specificity per se, which is consistent with the eat-4 loss-of-function phenotype seen above.
Fig. 3. Glutamate-gated chloride channels GLC-3 and GLC-4 are required for the ectopic synaptic formation. (A) A list of genes encoding four type of glutamate receptors tested for the role in the ectopic synaptic formation: AMPA receptors, NMDA receptors, metabotropic glutamate receptors and glutamate-gated chloride channels. (B-E) Representative confocal micrographs of the AIY synaptic vesicle marker GFP::RAB-3 (B and C) or active zone marker SYD-1::GFP (pseudo-red, D and E) in cima-1(wy84) (B and D), cima-1(wy84);glc-3(ok321);glc-4(ok212) (C and E). The dashed boxes indicate the zone 1 region. The scale bar in (B) is 10μm, applying to (C-E). (F) Quantification of the percentage of animals with the ectopic synapses in the AIY zone 1 region for indicated genotypes. Either glc-3(ok321) or glc-4(ok212) partially suppresses the ectopic synapses in cima-1(wy84), and the glc-3(ok321);glc-4(ok212) double mutations enhance each single mutation and suppress to the degree as eat-4(ky5) does. (G and H) Quantification of the ventral presynaptic length (G) and the ratio of the ventral to the total presynaptic length (H) based on the GFP::RAB-3 marker. (I-M) Representative confocal micrographs of the AIY presynaptic marker GFP::RAB-3 in wild-type (I), eat-4 overexpression (eat-4(OE)) (J), eat-4(OE);glc-3(ok321) (K), eat-4(OE);glc-4(ok212) (L) and eat-4(OE);glc-3(ok321);glc-4(ok212) (M) animals. The dashed boxes indicate the zone 1 region. The scale bar in (I) is 10μm, applying to (J-M). (N) Quantification of the percentage of animals with the ectopic synapses in the AIY zone 1 for indicated genotypes. Either glc-3(ok321) or glc-4(ok212) single mutation partially suppresses, while the glc-3(ok321);glc-4(ok212) double mutations completely abolish the ectopic AIY presynaptic distribution induced by eat-4(OE), indicating that the ectopic synapses induced by glutamate over-release is GLC-3- and GLC-4-dependent. For (F-H) and (N), the total number of independent animals (N) and the number of biological replicates (n1) are indicated in each bar for each genotype. And for the transgenic lines created in (F-H), the number of independent transgenic lines (n2) examined is indicated as the convention N/n1/n2. For (N), the transgene (eat-4(OE)) in these genotypes is from the same one transgenic line. Statistics are based on one-way ANOVA with Dunnett’s test (N and black columns in F) or unpaired t test (G, H and red columns in F). Error bars are SEM. **P< 0.01, ****P< 0.0001. Then, we tested the roles of those receptors in suppressing cima-1(wy84) mutant phenotype. Interestingly, two glutamate-gated chloride channel mutants, glc-3(ok321) and glc-4(ok212) partially but significantly suppressed the cima-1(wy84) ectopic synapses formation as assayed with the synaptic vesicle marker GFP::RAB-3 (89.91% of animals with ectopic synapses in cima-1(wy84); 53.91% in cima-1(wy84);glc-3(ok321); 67.57% in cima-1(wy84);glc-4(ok212), p<0.0001 and p = 0.0029 as compared to cima-1(wy84) respectively. S7A–S7U Fig), while the rest mutant receptors did not. And glc-3(ok321);glc-4(ok212) double mutations completely suppressed the ectopic synapses in cima-1(wy84) mutations (89.84% of animals with ectopic synapses in cima-1(wy84), 19.13% in cima-1(wy84);glc-3(ok321);glc-4(ok212), p<0.0001. Fig 3B, 3C and 3F). The suppression effect by glc-3(ok321);glc-4(ok212) was confirmed with the active zone marker GFP::SYD-1 (89.66% of animals with ectopic synapses in cima-1(wy84); 28.76% in cima-1(wy84);glc-3(ok321);glc-4(ok212), p<0.0001. Fig 3D–3F). Consistently, both the ventral synaptic length and the ratio of ventral to total synaptic length in cima-1(wy84) mutants were robustly suppressed by glc-3(ok321);glc-4(ok212) double mutations (the length and the ratio are 16.76μm and 0.34 in cima-1(wy84); vs 9.77μm and 0.22 in cima-1(wy84);glc-3(ok321);glc-4(ok212) mutants, P<0.0001 as compared to cima-1(wy84). Fig 3G and 3H). The role of glc-3(ok321) and glc-4(ok212) in suppressing cima-1 was confirmed by cima-1(gk902655) allele (S7V–S7Z Fig). Together, the data suggest that the ectopic synapse formation in cima-1 mutants requires the glutamate-gated chloride channels GLC-3 and GLC-4.
Next, we tested whether the ectopic synapses induced by eat-4(OE) also requires GLC-3 and GLC-4. We found that either glc-3(ok321) or glc-4(ok212) partially suppressed the eat-4(OE)-induced ectopic synapses (18.07% of animals with ectopic synapses in wild type; 66.46% in eat-4(OE), p<0.0001 as compared to wild type; 45.98% in eat-4(OE);glc-3(ok321), p = 0.0061 as compared to eat-4(OE); 44.38% in eat-4(OE);glc-4(ok212), p = 0.0032 as compared to eat-4(OE). Fig 3I–3L and 3N). Notably, glc-3(ok321);glc-4(ok212) double mutations completely suppressed the ectopic synaptic formation induced by eat-4(OE) (22.95% of animals with ectopic synapses in eat-4(OE);glc-3(ok321);glc-4(ok212), p<0.0001 as compared to eat-4(OE). Fig 3J, 3M and 3N). These data collectively suggest that eat-4(OE) promotes the AIY ectopic synaptic formation through the glutamate-gated chloride channels GLC-3 and GLC-4.
GLC-3 and GLC-4 act cell-autonomously in AIY to promote the ectopic synaptic formation
To understand where GLC-3 and GLC-4 act to promote the AIY ectopic synapse formation, we firstly determined where they were expressed by generating transcriptional reporter Pglc-3::GFP and Pglc-4::GFP, co-labeled with the AIY reporter Pttx-3::mCherry [69]. We found that both Pglc-3::GFP and Pglc-4::GFP were expressed in head neurons including the AIY (Fig 4A–4B’’). We also noticed that both glc-3 and glc-4 were expressed since the embryo stage (S3C-S3D’ Fig), which is consistent with their role in mediating the ectopic synapse formation of eat-4(OE) animals at the L1 stage (S5A–S5I Fig). Next, we performed cell-specific rescue by driving glc-3 or glc-4 cDNA with AIY specific (ttx-3) promoter [69], with endogenous promoters as controls. We found that expressing glc-3 or glc-4 with AIY specific ttx-3 promoter rescued the corresponding mutants to the degree as with the endogenous promoters (Fig 4C). Additionally, we found that overexpressing glc-3 and glc-4 simultaneously in the AIY of wild-type animals induced the ectopic synapses in eat-4-dependent manner (Fig 4D–4F and 4H). Those data reveal that two glutamate-gated chloride channels GLC-3 and GLC-4 act cell-autonomously in AIY to modulate the synaptic subcellular specificity.
Fig. 4. GLC-3 and GLC-4 act cell-autonomously in the AIY to promote the ectopic synapse formation. Given that GLC-3 and GLC-4 mediate inhibitory neurotransmission [51,87,88], we speculated that they induced the ectopic synapses through inhibiting AIY activity. To test this possibility, we expressed the gain-of-function potassium channel UNC-103(A334T) in AIY neurons. The gain of function UNC-103(A334T) can inhibit neuron excitability [89–92]. Indeed, the AIY-specific unc-103(gf) expression resulted in the AIY ectopic presynaptic formation in the zone 1 (Fig 4G and 4H), supporting the model that inhibiting the AIY activity is sufficient to induce the ectopic presynaptic assembly.
To directly examine if ASH-specific eat-4(OE) affects AIY activity, we recorded the calcium signaling in AIY with GCaMP6s[93]. We found while the amplitude of the automatic calcium oscillation was not affected, the frequency was dramatically reduced (Fig 4I–4K and S1 Video). These results support the model that the glutamate transmission from ASH promotes the AIY ectopic synaptic assembly through inhibiting its activity.
To further understand how GLC-3 and GLC-4 regulate AIY synaptic specificity, we determined GLC-3 and GLC-4 localization in AIY with AIY-specific mCherry::GLC-3 and mCherry::GLC-4 reporters. Interestingly, both GLC-3 and GLC-4 clusters largely overlapped with the synaptic marker GFP::RAB-3 in the zone 2 in wild-type or eat-4(ky5) mutants, and they were not present at the zone 1 region (Fig 5A–5B’ and 5F–5G’). In cima-1(wy84) or the ASH-specific eat-4(OE) animals, however, the GLC-3 and GLC-4 were also ectopically colocalized with the GFP::RAB-3 in the zone 1 region (Fig 5C, 5C’, 5E, 5E’, 5H, 5H’, 5J and 5J’). Loss of eat-4 suppressed the cima-1(wy84)-induced ectopic distribution of GLC-3 and GLC-4 as well as GFP::RAB-3 in the zone 1 (Fig 5D, 5D’, 5I and 5I’), suggesting that GLC-3 and GLC-4 probably act locally to promote presynaptic assembly.
Fig. 5. GLC-3 and GLC-4 are enriched at the synaptic region in AIY interneurons. (A-E’) Representative confocal micrographs of mCherry::GLC-3 and GFP::RAB-3 double labeling in AIY interneurons. The mCherry::GLC-3 (A-E) and GFP::RAB-3 are partially colocalized in wild type (A’), eat-4(ky5) (B’), cima-1(wy84) (C’), cima-1(wy84);eat-4(ky5) (D’) and the ASH-specific eat-4 overexpressed animals (E’). (F-J’) Representative confocal micrographs of mCherry::GLC-4 and GFP::RAB-3 double labeling in AIY interneurons. The mCherry::GLC-4 (F-J) and GFP::RAB-3 are partially colocalized in wild type (F’), eat-4(ky5) (G’), cima-1(wy84) (H’), cima-1(wy84);eat-4(ky5) (I’) and the ASH-specific eat-4 overexpressed animals (J’). GLC-3 and GLC-4 are ectopically localized to the zone 1 in cima-1(wy84) or ASH-specific eat-4 overexpressing animals. Scale bar in (A) is 10μm and applies to all images in Fig 5. ASH neurons are AIY presynaptic partners
Our above results demonstrate that overexpressing eat-4 specifically in ASH neurons promotes the AIY ectopic presynaptic formation through inhibiting its activity mediated by GLC-3/GLC-4 receptors. Those data implied that the ASH neurons most likely form synapses onto AIY, which was not reported previously [5,94]. To test this hypothesis, we examined electron microscopy (EM) reconstructions of three hermaphrodite nerve rings [5,95]. Interestingly, we found that ASH formed a chemical synapse onto AIY on one or both of the left-right pairs at the anterior region of zone 1, where the ectopic synapses begin to form in cima-1(wy84) or eat-4(OE) animals (Fig 6A and S2 Video) [5, 95]. And we found that the ASH neurons were extended posteriorly and aligned next to the AIY zone 1 in cima-1(wy84) mutants (S8A-S8B’’ Fig), which makes it possible for ASH to form extra synapses onto the AIY in the zone 1. Together, these data show that ASH neurons are AIY presynaptic partners, which suggests that the formation of the ectopic AIY presynaptic structure may be due to the ectopic synaptic connections between ASH and AIY.
Fig. 6. ASH neurons are AIY presynaptic partners. (A) Left: the 3D model shows the anatomic relationship between ASH and AIY. Right: nine consecutive high-resolution EM micrographs (slide 1, 5, and 9 are labeled in the 3D model) from an adult hermaphrodite show the synaptic connection between AIY and ASH at the anterior region of zone 1, near zone 2. Identified synapses from ASH to AIY are labeled with an arrowhead (image 3, 4, 5, 6). Scale bars are 1μm (left) and 250nm (right). High temperature alters synaptic subcellular specificity through glutamatergic signaling
To understand whether there is any physiological condition that can affect the AIY synaptic specificity, we tested the cultivation temperature since AIY is part of the thermotaxis circuit [46,51]. We examined the AIY presynaptic markers at a high physiological temperature (25°C) (Fig 7A). Wild-type animals can grow and reproduce normally at 25°C [96]. We found that the AIY morphology appeared largely intact at 25°C (S8A’ and S8C’ Fig). Interestingly, those animals displayed a highly penetrant ectopic synaptic structure as indicated by both GFP::RAB-3 and GFP::SYD-1 in the normally asynaptic zone 1 of AIY (GFP::RAB-3 : 16.83 vs 79.67% at 22°C and 25°C respectively, p<0.0001; GFP::SYD-1 : 15.79 vs 78.83% at 22°C and 25°C respectively, p<0.0001. Fig 7B–7F). Consistently, the ventral synaptic length and the ratio of the ventral to total synaptic length were increased at 25°C (8.53μm and 0.21 at 22°C; vs 16.88μm and 0.36 at 25°C, p<0.0001 for both comparisons. Fig 7G and 7H). The data indicate that high physiological temperature induces the ectopic synapses in AIY interneurons in wild-type animals.
Fig. 7. High temperature disrupts the synaptic subcellular specificity mediated by EAT-4, GLC-3 and GLC-4. (A) A schematic diagram shows the cultivation temperature conditions. The control group were cultivated at the constant 22°C (gray line). The high temperature group was transferred from 22°C (gray line) into 25°C (black line) since the parent generation (P0) young adult stage (YA: 12 hours post larval stage 4) until the next generation (F1) adult Day 1 stage when the phenotype was scored. (B-E) Representative confocal micrographs of the AIY synaptic vesicle marker GFP::RAB-3 (B and C) or active zone marker GFP::SYD-1 (pseudo-red, D and E). When cultivated at 22°C, the AIY presynaptic distribution is normal, as indicated with GFP::RAB-3 (B) and GFP::SYD-1 (D). However, when cultivated at 25°C, the ectopic synapses emerge in the zone 1 region (C, E). Dashed boxes indicate the zone 1 region of AIY. The scale bar in (B) is 10μm and applies to (C-E). (F-H) Quantification of the percentage of animals with ectopic AIY synaptic vesicle GFP::RAB-3 (black bars) and active zone GFP::SYD-1 (red bars) (F), the ventral synaptic length (G) and the ratio of the ventral to the total synaptic length (H). Both (G) and (H) are based on the GFP::RAB-3, and each spot represents the value from one independent AIY. The total number of independent animals (N) and the number of biological replicates (n1) are indicated in each bar for each genotype as N/n1. And for the transgenic lines created in F, the number of independent transgenic lines (n2) examined is indicated as the convention N/n1/n2. Error bars are SEM. ****P< 0.0001. Statistics are based on unpaired t test. (I-P) Representative confocal micrographs of the AIY GFP::RAB-3 in wild-type (I), eat-4(ky5) (J, O), glc-3(ok321) (K), glc-4(ok212) (L), and glc-3(ok321);glc-4(ok212) (M), eat-4(ky5) with ASH-specific expressing eat-4 (Pnhr-79) transgenes (N, P) at 25°C (I, J, K, L, M) or 22°C (O, P). Dashed boxes mark the zone 1 of AIY interneurons. The scale bar in (I) is 10μm and applies to (J-P). (Q) Quantification of the percentage of animals with ectopic AIY synaptic sites in the zone 1 region corresponding to (I-M). The data indicate that eat-4(ky5), glc-3(ok321) or glc-4(ok212) mutations robustly inhibit the ectopic synapse formation induced by high temperature (25°C). (R) Quantification of the percentage of animals with ectopic synapses in AIY zone 1 region for the indicated conditions/genotypes. eat-4 expressed in the ASH significantly restores the ectopic synapses in eat-4(ky5) mutants at 25°C, which is more robust than that at 22°C. For Q and R, the total number of independent animals (N) and the number of biological replicates (n1) are indicated in each bar for each genotype as N/n1. And for the transgenic lines created in R, the number of transgenic lines (n2) examined is indicated as the convention N/n1/n2. Error bars are SEM. **P< 0.01, ****P< 0.0001. Statistics are based on one-way ANOVA with Dunnett’s test. (S-T’) Representative confocal micrographs of Psra-6::EAT-4-PHluorin and Psra-6::mCherry double labeling in wild-type animals cultivated at 22°C(S, S’) and 25°C(T, T’). The ROI is the axon of ASH neurons which is marked by skewed bracket (S, T). The scale bar in (S) is 10μm and applies to (S’, T-T’). (U) The relative ASH::EAT-4-PHluorin fluorescent intensity in wild-type animals cultivated in 22°C and 25°C. Each data point represents a single independent animal. The total number of independent animals (N) and the number of biological replicates (n) are indicated in each bar for each genotype as N/n. Error bars are SEM. ***P = 0.0002. Statistics are based on unpaired t test. Next, we asked whether the low temperature could inhibit the AIY ectopic synapses. To address this question, we quantified the AIY presynaptic phenotype in both wild-type and cima-1(wy84) animals at 15°C and 22°C. We found that the ectopic synapses were indeed reduced both in the wild-type and cima-1(wy84) animals at 15°C as compared to that at 22°C (S9A and S9B Fig). To exclude the possibility that the phenotypic difference was due to the slow development rate at 15°C, we also quantified the synaptic phenotype at the adult Day 2 stage and found similar results (S9A and S9B Fig). Those data indicate that high temperature promotes, while low temperature suppresses the AIY ectopic synaptic assembly.
To determine the temporal window required for high temperature to promote the AIY ectopic synapse formation, animals were shifted to 25°C during different developmental stages (S9C Fig). Interestingly, the AIY ectopic synapse formation required the high temperature treatment during developmental stages, with more robust effect during embryonic stages (S9D Fig). No ectopic synapse was observed when treating from the larval L4 stage (S9D Fig). The results suggest that the AIY ectopic synaptic formation induced by high temperature is development-dependent.
Given that glutamate signaling is required for the AIY ectopic synaptic formation in cima-1 mutants, we asked whether it was also required for the high temperature induced ectopic synapse formation. We examined the phenotype of eat-4(ky5) mutants at 25°C. Interestingly, eat-4(ky5) suppressed the AIY ectopic synapse formation at high temperature (82.43% and 20.81% of animals with ectopic synapses in wild-type and eat-4(ky5) mutants respectively, p<0.0001, Fig 7I, 7J and 7Q). The data demonstrate that glutamatergic neurotransmission is required for the AIY ectopic synaptic formation at high temperature.
Next, we determined whether GLC-3 and GLC-4 were required by examining the mutant phenotype at 25°C. Indeed, either glc-3(ok321) or glc-4(ok212) mutation partially, while the glc-3(ok321);glc-4(ok212) double mutations completely inhibited the ectopic synapses at 25°C (Fig 7K, 7L, 7M and 7Q). These results indicate that high temperature induces the AIY ectopic synaptic formation mediated by the glutamatergic GLC-3/GLC-4 receptors.
Given that the AIY ectopic synaptic formation in eat-4(OE) or cima-1 mutant animals require glutamate transmission from ASH neurons, we asked whether ASH neurons were also required for the high temperature induced AIY ectopic synaptic formation. Through cell specific eat-4 rescue experiments, we found that expressing eat-4 specifically in the ASH neurons significantly restored the ectopic synapses in eat-4(ky5) mutants at 25°C, which was more robust than that at 22°C (Fig 7N–7P and 7R), suggesting that ASH neurons are involved in high temperature induced AIY ectopic synaptic formation.
To visualize the anatomic relationship between ASH and AIY at high temperature, we labeled the ASH and AIY with cytoplasmic GFP and mCherry simultaneously, and found ASH process extended posteriorly alongside the AIY zone 1 (S8C-8C’’ Fig), suggesting that ASH could form synapses onto AIY in this region.
To address whether high temperature enhances the glutamate release from ASH, we quantified the intensity of the ASH VGLUT-pHluorin. PHluorin is a fluorescent protein quenched in acidic conditions such as inside the synaptic vesicle lumen [97]. We found that VGLUT-pHluorin intensity was enhanced in the ASH axon at high temperature, suggesting more glutamate vesicles releasing from ASH neurons (Fig 7S–7U). These results are consistent with the model that high temperature induces the AIY ectopic synaptic formation by enhancing the ASH glutamatergic neurotransmission.
Although 25°C is at the border line of the normal breeding temperature range (15–25°C), this could be a potential stress condition. To address if other stress conditions could induce the ectopic synapse formation, we tested the effect of osmotic and oxidative stresses on the AIY synaptic subcellular specificity, and found that animals treated with 200~500mM sorbitol or 0~10mM hydrogen peroxide displayed normal AIY synaptic distribution (S10 Fig), suggesting that the ectopic AIY synapses are not induced by general stresses.
Discussion
Our previous study identified that cima-1 in epidermis is required for the normal AIY presynaptic distribution. cima-1 functions partially through the VCSC glia [55]. In this study, we uncover an inhibitory glutamate signaling that is required for the cima-1(wy84)-induced AIY ectopic synaptic formation (Fig 8A). Furthermore, we show that eat-4(OE) or high temperature can trigger the glutamate signaling from ASH sensory neurons to promote the ectopic presynaptic formation, which is mediated by the inhibitory glutamate gated chloride channels GLC-3 and GLC-4 in the AIY interneurons. These findings describe a novel mechanism underlying synaptic subcellular specificity.
Fig. 8. A model explaining the AIY synaptic subcellular specificity. (A) A model explaining the AIY synaptic subcellular specificity. CIMA-1 in epidermal cells regulates the AIY presynaptic subcellular specificity by two pathways: VCSC glia signaling and glutamatergic signals. The glutamatergic signaling, which can also be increased by eat-4(OE) or high cultivation temperature, promotes the ectopic distribution of GLC-3 (dark blue) and GLC-4 (light blue) receptors in the AIY zone 1 region, where these receptors regulate the ectopic presynaptic formation. ASH neurons form inhibitory synapses onto the AIY
In this study, we demonstrate that ASH forms inhibitory synapses on the AIY interneurons. Four lines of evidence support this. First, ASH processes are aligned next to the AIY, which indicates ASH may form synapses onto AIY (S8 Fig). Secondly, through tissue-specific expression analysis, we showed that the glutamate required for the AIY ectopic synaptic formation is released from the ASH neurons and sensed by the GLC-3/GLC-4 receptors in the AIY. Thirdly, ASH specific eat-4(OE) reduces the frequency of AIY Ca2+ oscillation, indicating that ASH inhibits AIY excitability. Finally, the ASH-AIY synaptic connection was confirmed by electron microscopy reconstruction [95].
The next question is why expressing eat-4 in other AIY presynaptic glutamatergic neurons such as AFD and AWC does not rescue. There are two possibilities. First, the amount or frequency of the glutamate released from ASH could be much higher than from any of other AIY presynaptic neurons. Second, the ASH-AIY synapses, which localizes at the border of zone 2 and zone 1 in the wild-type animals, are closer to the ectopic synaptic sites in the zone 1 than those of AFD-AIY or AWC-AIY. Therefore, the glutamate from ASH can diffuse more easily to the zone 1 region where it probably locates the GLC-3/GLC-4 receptors and promotes the ectopic synaptic assembly.
In vertebrates, excitatory neuronal activity is well recognized for its role in modulating excitatory synapse formation, maturation and plasticity [98–100]. More recently, GABAergic activity was also found to regulate both inhibitory and excitatory synaptic development at early developmental stage through depolarizing the postsynaptic neurons [101,102]. However, our knowledge about the role of GABA activity in promoting synaptic formation is largely limited to the early developmental stage when GABA acts as an excitatory transmitter [103]. In this study, we demonstrated that an important role of the inhibitory ASH-AIY synaptic transmission in promoting ectopic excitatory presynaptic assembly in the postsynaptic AIY neurons. The future work should focus on understanding the underlying molecular mechanisms.
Pentameric ligand-gated ion channels regulate synaptic specificity
Glutamate signals promote the AIY ectopic synaptic formation through two pentameric ligand-gated ion channels GLC-3 and GLC-4, which are localized to the AIY presynaptic region, partially overlapping with the presynaptic marker RAB-3. Unlike a typical bipolar neuron, which assembles presynaptic and postsynaptic structures in axons or dendrites, AIY presynaptic and postsynaptic sites are overlapping along the single neurite in zone 2 and 3 regions [5]. The close anatomic relationship between postsynaptic and presynaptic sites may be helpful for the activity-dependent presynaptic assembly. Alternatively, GLC-3 and GLC-4 may also localize to the presynaptic sites. In this case, GLC-3 and GLC-4 may be activated by the glutamate spillover from adjacent synapses.
Glutamate spillover plays physiological or pathological roles [104–107]. The loss of astrocyte-like VCSC glia or glutamate reuptake transporter GLT-1 can alter the animal escaping or exploration behavior [107]. Increasing the extracellular level of glutamate may also result in neurotoxicity and degeneration [104,108]. Similar functions of glutamate present in mammals [105,106].
The inhibitory neurotransmitter receptors such as GABA receptors were also found in the excitatory presynaptic boutons in mammalian brain, where they play important roles in regulating synaptic transmission [109–112]. However, it is largely unknown if these presynaptic inhibitory receptors are involved in synaptic development or plasticity.
The closest related mammalian homologs of GLC-3 and GLC-4 are glycine receptors (GlyRs) [113–115]. GlyRs are one of the major inhibitory neurotransmitter receptors, involved not only in neuronal signaling processing, but also in neurodevelopment [116]. GlyRs regulate postsynaptic protein clustering in immature rat spinal neurons [117], and cortical interneuron migration in mouse [116]. Mutations of GlyRs are associated with a number of neurological disorders including hyperekplexia, temporal lobe epilepsy, chronic inflammatory pain, autism, etc, which makes GlyRs potential drug targets [118]. Given the functional conservation of pLGIC family receptors, C. elegans GLC-3 and GLC-4 may provide an excellent model to address the mechanisms underlying physiological and pathological roles of GlyRs.
Temporal regulation of spatial specificity
During embryonic development, the AIY presynaptic assembly in zone 2 region is mainly regulated by netrin/DCC secreted from the VCSC glia [6]. However, it is largely unknown how the zone 1 avoids synaptic assembly. In this study, we found that the amount of glutamate released from ASH is critical for the synaptic assembly in zone 1 region. Although glutamatergic neurotransmission from ASH is also required for the ectopic synapse formation in cima-1(wy84) mutants, we noticed that the synaptic subcellular defects are different between cima-1(wy84) and eat-4(OE) animals. The ectopic synapses appear since newly hatched larval L1 stage in eat-4(OE) animals and at the adult stage in cima-1 mutants [55]. Additionally, the VCSC glia contribute more to the synaptic defect of cima-1(wy84) than that of eat-4(OE). Those differences indicate that cima-1(wy84) and eat-4(OE) may regulate the synaptic subcellular specificity through different molecular mechanisms.
Environmental temperature affects synaptic subcellular specificity
In this study, we showed that the synaptic subcellular specificity was affected by temperature during developmental stages. Specifically, we showed that high temperature promoted the ectopic synaptic formation mediated by the vesicle glutamate transporter VGLUT/EAT-4 in ASH and glutamate receptors GLC-3/GLC-4 in AIY, while low temperature inhibited the ectopic synaptic assembly. This finding suggests that temperature modulates the synaptic subcellular specificity through glutamatergic neurotransmission. No ectopic synapse observed under osmotic or oxidative stresses suggests the synaptic specificity is not affected by general stresses.
The AIY interneurons are part of the thermosensory circuit involved in the thermotaxis behavior [46–51]. Previous studies have identified that AFD, AWC and ASI are major thermosensory neurons [46,51–54,119]. In this study, we found that ASH sensory neurons could sense the cultivation temperature and regulate the AIY synaptic subcellular specificity, suggesting that the ASH could be part of the thermosensory circuit, which should be further tested in the future.
Temperature is a common and vital environmental factor for many organisms. The nervous system is very sensitive to high temperature during embryogenesis [120]. High temperature often results in neurological disorders including neural tube defects, microcephaly, microphthalmia, microvascular abnormity in vertebrates [120]. In Drosophila, high temperature also induces neural developmental defects [21,23,121,122]. Temperature can modulate the nematode C. elegans thermotaxis behaviors and lifespan mediated by neuronal activity [123–125]. In our study, the effects of temperature on synaptic subcellular specificity provide an excellent model to address the mechanistic insights into the high temperature induced neurodevelopmental defects in vivo.
Materials and methods
Strains and cultivation
Strains were cultivated on OP50-seeded nematode growth medium (NGM) plates at 22°C unless specified [126]. Wild-type (WT) animals are Bristol strain N2. Mutant alleles used in this study include:
LGI: unc-13(e1091), avr-14(ad1302), glc-2(gk179), mgl-2(tm355), glr-3(tm6403)
LGII: cat-2(e1112), glc-4(ok212), nmr-1(ak4), glr-4(tm3239)
LGIII: eat-4(ky5), eat-4(nj2), eat-4(nj6), unc-47(n2409), glr-1(n2461), glr-2(ok2342)
LGIV: cima-1(wy84), cima-1(gk902655), unc-17(cn355), mgl-3(tm1766)
LGV: avr-15(ad1051), glc-1(pk54), glc-3(ok321), nmr-2(ok3324), glr-5(tm3506)
LGX: mgl-1(tm1811), glr-6(tm2729), glr-7(tm1824)
All worm strains used in this study are listed in the S1 Excel.
Plasmids and transgenic manipulations
Plasmids were made in the pSM or pPD49.26 by recombination [127]. The transgenic strains carrying extrachromosomal DNA arrays were generated using standard microinjection protocol [128]. The following plasmids were used as co-injection markers: Phlh-17::mCherry, Pmyo-3::mCherry, Punc-122::GFP, Punc-122::RFP or Plin44::mCherry. Unless otherwise stated in S1 Excel, the concentration of plasmids was injected at 20 ng/μl. The cDNA plasmids generated for use in this study (glc-3 cDNA, glc-4 cDNA), were cloned by RT-PCR from total RNA isolated from WT (N2) worms. The unc-103A334T cDNA was amplified from the strain SQC0132 [yfhIx0132 (Punc-103::unc-103A334T::GFP)] [92], which is a gift from Dr. Shiqing Cai. The eat-4 cDNA was cloned from the plasmid Peat-4a::eat-4 (cDNA)::GFP [51] from Dr. Ikue Mori. The Psra-6::caspase p12 and Psra-6::caspase p17 constructs were modified from plasmids DACR336(Pttx-3::caspase p12) and DACR335(Pttx-3::caspase p17) respectively through replacing the ttx-3 promoter with sra-6 promoter (4kb) by recombination[50,83].
The ASH-specific EAT-4(VGLUT)-pHluorin expression construct was created through inserting the PHluorin CDS into the Psra-6::eat-4a[129]. The PHluorin was inserted after the conserved glycine residue at position 106 of eat-4 A isoform cDNA by PCR primers which adds 42 bases (TCTACCTCTGGAGGATCTGGAGGAACCGGAGGATCTATGGGA) for the upstream linker, 45 bases (ACCGGTGGAGGAACCGGAGGAACCGGAGGA TCTGGAGGAACCGGA) for downstream linker, as previously described [129]. Forward primer to amplify PHluorin: 5’ - GAGGATCTGGAGGAACCGGAGGATCTATGGGAAGTAAAGGAGAAGAACTTTTC-3’. Reverse primer to amplify PHluorin: 5’ - CTCCAGATCCTCCGGTTCCTCCGGTTCCTCCACCGGTTTTGTATAGTTCATCC-3’. The vector were amplified from the Psra-6::eat-4 plasmids with forward primer: 5’-ACCGGAGGAACCGGAGGATCTGGAGGAACCGGAAAAGTTCAT ATGCATGAATTC-3’ and reverse primer: 5’-GATCCTCCGGTTCCTCCAGATC CTCCAGAGGTAGATCCGTATGGATCTGTATAATTTT-3’. All plasmids and primer information in this study were listed in the S2 Excel.
ASH and glia ablation
The two-component system of reconstituted caspase (recCaspase) [83] was driven by the sra-6 promoter, which specifically ablating the ASH neurons. Ablation was confirmed by lack of ASH specific marker (kyIs39) [78].
The two-component system of reconstituted caspase (recCaspase) [83] was driven by the hlh-17 promoter, which specifically ablating the CEPsh glia. Ablation was confirmed by lack of the CEPsh-specific marker(nsIs105) [107].
Electron microscopy analysis
Serial-section electron microscopy datasets were imported into CATMAID [130] to peruse. Each section containing AIY was examined to determine if contact was made with ASH, and if so, whether chemical synapses were present. Chemical synapses were defined as a presynaptic bouton containing a pool of synaptic vesicles as well as a dense presynaptic projection inside the membrane.
Special temperature treatment
Animals was transferred to 15°C or 25°C at specific time points as illustrated in the figures. The phenotype of next or the same generation was scored at the adult Day 1 or Day 2 stage. In these assays, animal synchronization was done through two steps. First, eggs were collected within one-hour time window; second, animals were synchronized at the L4 stage.
Osmotic stress assays
Young adults were grown on NGM agar plates containing 0mM(control), 200mM, 300mM, 400mM or 500 mM sorbitol seeded with OP50 until they reached the adult Day 1 stage when the synaptic phenotype was scored. The concentrations and methods were modified from the study of Chandler-Brown et al. [131].
Oxidative stress assays
Young adults were grown on NGM agar plates with OP50 and supplemented with S-basal buffer containing hydrogen peroxide (0.5mM, 2mM, 5mM,10 mM) at specific time points as illustrated in the figures. Animals were synchronized at the L4 stage and phenotypes were scored 24 hours later. The concentrations were modified from Lee et al. [132]. Animals can survive and reproduce at low concentration of H2O2 (0.5mM, 2mM) from the young P0 stage, but not at higher than 5mM. We also treated animals with high concentrations (5mM, 10mM) for shorter time (time window4 in the high temperature treatment).
Calcium imaging of AIY neurons
For in vivo calcium imaging, individual Day 1 (D1) adult hermaphroditic worms were immobilized with Polybead Microspheres 0.10μm (Polysciences) on 12% agarose pads. Fluorescent images were acquired using an Andor Dragonfly Spinning Disc Confocal Microscope with 60x objectives coupled with an ZYLA camera. GCaMP6s (in AIY) was excited by 488nm excitation wavelength lasers, and the mCherry control was imaged with 561 nm excitation wavelength lasers. The fluorescent signals of video were collected at the rate of 2 Hz[133].
For AIY GCaMP signals, the ROI is AIY neurite (Zone 2 and Zone 1). The relatively GCaMP signals for each data point were calculated as:
For peak frequency of AIY GCaMP was taken as Fn, which was calculated as:
For peak amplitude of AIY GCaMP was calculated as:
The data of fluorescence intensity was quantified with the ImageJ (Fiji).
Fluorescence microscopy and confocal imaging
Confocal images were acquired with an Andor Dragonfly Spinning Disc Confocal Microscope with 40x or 60x objectives. The fluorescently tagged fusion proteins GFP or mCherry was imaged with 488 or 561 nm excitation wavelength lasers, respectively. Animals were anesthetized with 50mM muscimol or Polybead Microspheres 0.10μm (the recorded about GCaMP and PHluorin). Images were processed with Imaris, ImageJ (Fiji) and Photoshop. All images are oriented anterior to the left and dorsal up.
Quantification and statistical analysis
To quantify the percentage of animals with ectopic synapses of AIY zone 1 at the adult stage, animals were synchronized at larva stage 4 (L4) and then we scored the phenotypes 24 hours later using a Nikon Ni-U fluorescent microscope with 40x objectives or Andor Dragonfly Spinning Disc Confocal Microscope with 40x objectives. For the larval phenotypes, synchronized eggs were cultivated for 12 and 48 hours to reach the middle stage of L1 and L4. At least three biological replicates were done for each quantification. For transgenic analysis, at least two independent transgenic lines were generated and quantified unless specified. The data of AIY ectopic synapses were blindly recorded. Other data were collected based on genotypes or treatments. All quantitative raw data are in S3 Excel.
For ASH EAT-4-PHluorin intensity, the ROI is ventral axon of ASH. The relatively PHluorin intensity for each data point were calculated as: FPHluorin/FmCherry.
The data of fluorescence intensity was collected using the ImageJ (Fiji).
Statistical analyses were conducted with GraphPad Prism software (version 6.01). The comparisons between two groups were determined by the unpaired t test, while multiple comparisons were analyzed with one-way analysis of variance with Dunnett’s multiple comparison test. Error bars represent the standard errors of the mean (SEM).
Supporting information
S1 Fig [a]
Neurotransmission are not required for synaptic subcellular specificity per se.S2 Fig [wy84]
GABAergic, cholinergic and dopaminergic neurotransmissions are not required for the ectopic synaptic formation in .S3 Fig [a]
The expression of begins at the embryo stage.S4 Fig [a]
The AIY ectopic synapses induced by (OE) is largely independent of the VCSC glia.S5 Fig [oe]
promotes the AIY ectopic synapse formation since L1 stage.S6 Fig [a]
Glutamate receptors are not required for AIY synaptic subcellular specificity per se.S7 Fig [a]
Glutamate-gated chloride channels GLC-3 and GLC-4 are required for the ectopic synapse formation in .S8 Fig [wy84]
The ASH axons are extended posteriorly and overlap with AIY zone 1 in and 25°C treated wild-type animals.S9 Fig [a]
Temperature alters the synaptic subcellular specificity.S10 Fig [a]
Osmotic and oxidative stresses do not affect the AIY synaptic subcellular specificity.S1 Excel [xlsx]
The detail information for strains used in this study.S2 Excel [xlsx]
The primer sequence information.S3 Excel [xlsx]
The archive of raw quantitative data.S1 Video [mp4]
The AIY GCaMP fluorescent video in wild-type and Psra-6::EAT-4 transgenic animals.S2 Video [mp4]
The 3D model showed the anatomic relationship between ASH and AIY.
Zdroje
1. Sanes JR, Yamagata M. Many paths to synaptic specificity. Annu Rev Cell Dev Biol. 2009;25 : 161–195. doi: 10.1146/annurev.cellbio.24.110707.175402 19575668
2. Shen K, Scheiffele P. Genetics and cell biology of building specific synaptic connectivity. Annu Rev Neurosci. 2010;33 : 473–507. doi: 10.1146/annurev.neuro.051508.135302 20367446
3. Yogev S, Shen K. Cellular and molecular mechanisms of synaptic specificity. Annu Rev Cell Dev Biol. 2014;30 : 417–437. doi: 10.1146/annurev-cellbio-100913-012953 25150010
4. Ango F, Cristo Gd, Higashiyama H, Bennett V, Wu P, Huang ZJ. Ankyrin-Based Subcellular Gradient of Neurofascin, an Immunoglobulin Family Protein, Directs GABAergic Innervation at Purkinje Axon Initial Segment. Cell. 2004;119(2):257–272. doi: 10.1016/j.cell.2004.10.004 15479642
5. White JG, Southgate E, Thomson JN, Brenner S. The structure of the nervous system of the nematode Caenorhabditis elegans. Philosophical transactions of the Royal Society of London Series B, Biological sciences. 1986;314(1165):1–340. doi: 10.1098/rstb.1986.0056 22462104
6. Colón-Ramos DA, Margeta MA, Kang S. Glia promote local synaptogenesis through UNC-6 (netrin) signaling in C. elegans. Science. 2007;318(5847):103–106. doi: 10.1126/science.1143762 17916735
7. Di Cristo G, Wu C, Chattopadhyaya B, Ango F, Knott G, Welker E, et al. Subcellular domain-restricted GABAergic innervation in primary visual cortex in the absence of sensory and thalamic inputs. Nat Neurosci. 2004;7(11):1184–1186. doi: 10.1038/nn1334 15475951
8. Huang ZJ. Subcellular organization of GABAergic synapses: role of ankyrins and L1 cell adhesion molecules. Nat Neurosci. 2006;9(2):163–166. doi: 10.1038/nn1638 16439983
9. Klassen MP, Shen K. Wnt signaling positions neuromuscular connectivity by inhibiting synapse formation in C. elegans. Cell. 2007;130(4):704–716. doi: 10.1016/j.cell.2007.06.046 17719547
10. Betley JN, Wright CV, Kawaguchi Y, Erdelyi F, Szabo G, Jessell TM, et al. Stringent specificity in the construction of a GABAergic presynaptic inhibitory circuit. Cell. 2009;139(1):161–174. doi: 10.1016/j.cell.2009.08.027 19804761
11. Williams ME, Wilke SA, Daggett A, Davis E, Otto S, Ravi D, et al. Cadherin-9 regulates synapse-specific differentiation in the developing hippocampus. Neuron. 2011;71(4):640–655. doi: 10.1016/j.neuron.2011.06.019 21867881
12. Ashrafi S, Betley JN, Comer JD, Brenner-Morton S, Bar V, Shimoda Y, et al. Neuronal Ig/Caspr recognition promotes the formation of axoaxonic synapses in mouse spinal cord. Neuron. 2014;81(1):120–129. doi: 10.1016/j.neuron.2013.10.060 24411736
13. Poon VY, Klassen MP, Shen K. UNC-6/netrin and its receptor UNC-5 locally exclude presynaptic components from dendrites. Nature. 2008;455(7213):669–673. doi: 10.1038/nature07291 18776887
14. Mizumoto K, Shen K. Interaxonal interaction defines tiled presynaptic innervation in C. elegans. Neuron. 2013;77(4):655–666. doi: 10.1016/j.neuron.2012.12.031 23439119
15. Shen K, Bargmann CI. The immunoglobulin superfamily protein SYG-1 determines the location of specific synapses in C. elegans. Cell. 2003;112(5):619–630. doi: 10.1016/s0092-8674(03)00113-2 12628183
16. Shen K, Fetter RD, Bargmann CI. Synaptic specificity is generated by the synaptic guidepost protein SYG-2 and its receptor, SYG-1. Cell. 2004;116(6):869–881. doi: 10.1016/s0092-8674(04)00251-x 15035988
17. West AE, Greenberg ME. Neuronal activity-regulated gene transcription in synapse development and cognitive function. Cold Spring Harb Perspect Biol. 2011;3(6). doi: 10.1101/cshperspect.a005744 21555405
18. Penn AA. Early brain wiring: activity-dependent processes. Schizophr Bull. 2001;27(3):337–347. doi: 10.1093/oxfordjournals.schbul.a006880 11596840
19. Luhmann HJ, Khazipov R. Neuronal activity patterns in the developing barrel cortex. Neuroscience. 2018;368 : 256–267. doi: 10.1016/j.neuroscience.2017.05.025 28528963
20. Frohlich A, Meinertzhagen IA. Cell recognition during synaptogenesis is revealed after temperature-shock-induced perturbations in the developing fly's optic lamina. Journal of neurobiology. 1993;24(12):1642–1654. doi: 10.1002/neu.480241208 8301271
21. Sigrist SJ, Reiff DF, Thiel PR, Steinert JR, Schuster CM. Experience-dependent strengthening of Drosophila neuromuscular junctions. J Neurosci. 2003;23(16):6546–6556. doi: 10.1523/JNEUROSCI.23-16-06546.2003 12878696
22. Peng IF, Berke BA, Zhu Y, Lee WH, Chen W, Wu CF. Temperature-dependent developmental plasticity of Drosophila neurons: cell-autonomous roles of membrane excitability, Ca2+ influx, and cAMP signaling. J Neurosci. 2007;27(46):12611–12622. doi: 10.1523/JNEUROSCI.2179-07.2007 18003840
23. Zhong Y, Wu CF. Neuronal activity and adenylyl cyclase in environment-dependent plasticity of axonal outgrowth in Drosophila. J Neurosci. 2004;24(6):1439–1445. doi: 10.1523/JNEUROSCI.0740-02.2004 14960616
24. Black B, Vishwakarma V, Dhakal K, Bhattarai S, Pradhan P, Jain A, et al. Spatial temperature gradients guide axonal outgrowth. Sci Rep. 2016;6 : 29876. doi: 10.1038/srep29876 27460512
25. Chopra M, Singh S. Developmental temperature selectively regulates a voltage-activated potassium current in Drosophila. Journal of neurobiology. 1994;25(2):119–126. doi: 10.1002/neu.480250204 8021644
26. Galli L, Maffei L. Spontaneous impulse activity of rat retinal ganglion cells in prenatal life. Science. 1988;242(4875):90–91. doi: 10.1126/science.3175637 3175637
27. Wiesel TN, Hubel DH. SINGLE-CELL RESPONSES IN STRIATE CORTEX OF KITTENS DEPRIVED OF VISION IN ONE EYE. J Neurophysiol. 1963;26 : 1003–1017. doi: 10.1152/jn.1963.26.6.1003 14084161
28. Katz LC, Shatz CJ. Synaptic activity and the construction of cortical circuits. Science. 1996;274(5290):1133–1138. doi: 10.1126/science.274.5290.1133 8895456
29. Oland LA, Pott WM, Bukhman G, Sun XJ, Tolbert LP. Activity blockade does not prevent the construction of olfactory glomeruli in the moth Manduca sexta. International journal of developmental neuroscience: the official journal of the International Society for Developmental Neuroscience. 1996;14(7–8):983–996.
30. Jefferis GS, Vyas RM, Berdnik D, Ramaekers A, Stocker RF, Tanaka NK, et al. Developmental origin of wiring specificity in the olfactory system of Drosophila. Development. 2004;131(1):117–130. doi: 10.1242/dev.00896 14645123
31. Hiesinger PR, Zhai RG, Zhou Y, Koh TW, Mehta SQ, Schulze KL, et al. Activity-independent prespecification of synaptic partners in the visual map of Drosophila. Curr Biol. 2006;16(18):1835–1843. doi: 10.1016/j.cub.2006.07.047 16979562
32. Kratsios P, Pinan-Lucarré B, Kerk SY, Weinreb A, Bessereau JL, Hobert O. Transcriptional coordination of synaptogenesis and neurotransmitter signaling. Curr Biol. 2015;25(10):1282–1295. doi: 10.1016/j.cub.2015.03.028 25913400
33. Gally C, Bessereau JL. GABA is dispensable for the formation of junctional GABA receptor clusters in Caenorhabditis elegans. J Neurosci. 2003;23(7):2591–2599. doi: 10.1523/JNEUROSCI.23-07-02591.2003 12684444
34. Jin Y, Jorgensen E, Hartwieg E, Horvitz HR. The Caenorhabditis elegans gene unc-25 encodes glutamic acid decarboxylase and is required for synaptic transmission but not synaptic development. J Neurosci. 1999;19(2):539–548. doi: 10.1523/JNEUROSCI.19-02-00539.1999 9880574
35. Sachse S, Rueckert E, Keller A, Okada R, Tanaka NK, Ito K, et al. Activity-dependent plasticity in an olfactory circuit. Neuron. 2007;56(5):838–850. doi: 10.1016/j.neuron.2007.10.035 18054860
36. Tessier CR, Broadie K. Activity-dependent modulation of neural circuit synaptic connectivity. Front Mol Neurosci. 2009;2 : 8. doi: 10.3389/neuro.02.008.2009 19668708
37. Golovin RM, Broadie K. Developmental experience-dependent plasticity in the first synapse of the Drosophila olfactory circuit. J Neurophysiol. 2016;116(6):2730–2738. doi: 10.1152/jn.00616.2016 27683892
38. Grunwald Kadow IC. State-dependent plasticity of innate behavior in fruit flies. Curr Opin Neurobiol. 2019;54 : 60–65. doi: 10.1016/j.conb.2018.08.014 30219668
39. Peckol EL, Zallen JA, Yarrow JC, Bargmann CI. Sensory activity affects sensory axon development in C. elegans. Development. 1999;126(9):1891–1902. 10101123
40. Zhao H, Nonet ML. A retrograde signal is involved in activity-dependent remodeling at a C. elegans neuromuscular junction. Development. 2000;127(6):1253–1266. 10683178
41. Cohn JA, Cebul ER, Valperga G, Brose L, de Bono M, Heiman MG, et al. Long-term activity drives dendritic branch elaboration of a C. elegans sensory neuron. Dev Biol. 2020;461(1):66–74. doi: 10.1016/j.ydbio.2020.01.005 31945343
42. Hart MP, Hobert O. Neurexin controls plasticity of a mature, sexually dimorphic neuron. Nature. 2018;553(7687):165–170. doi: 10.1038/nature25192 29323291
43. Horowitz LB, Brandt JP, Ringstad N. Repression of an activity-dependent autocrine insulin signal is required for sensory neuron development in C. elegans. Development. 2019;146(22). doi: 10.1242/dev.182873 31628111
44. Thompson-Peer KL, Bai J, Hu Z, Kaplan JM. HBL-1 patterns synaptic remodeling in C. elegans. Neuron. 2012;73(3):453–465. doi: 10.1016/j.neuron.2011.11.025 22325199
45. Cuentas-Condori A, Mulcahy B, He S, Palumbos S, Zhen M, Miller DM 3rd. C. elegans neurons have functional dendritic spines. Elife. 2019;8. doi: 10.7554/eLife.47918 31584430
46. Mori I, Ohshima Y. Neural regulation of thermotaxis in Caenorhabditis elegans. Nature. 1995;376(6538):344–348. doi: 10.1038/376344a0 7630402
47. Ryu WS, Samuel AD. Thermotaxis in Caenorhabditis elegans analyzed by measuring responses to defined Thermal stimuli. J Neurosci. 2002;22(13):5727–5733. doi: 20026542 12097525
48. Gray JM, Hill JJ, Bargmann CI. A circuit for navigation in Caenorhabditis elegans. Proc Natl Acad Sci U S A. 2005;102(9):3184–3191. doi: 10.1073/pnas.0409009101 15689400
49. Ikeda M, Nakano S, Giles AC, Xu L, Costa WS, Gottschalk A, et al. Context-dependent operation of neural circuits underlies a navigation behavior in Caenorhabditis elegans. Proc Natl Acad Sci U S A. 2020;117(11):6178–6188. doi: 10.1073/pnas.1918528117 32123108
50. Luo L, Cook N, Venkatachalam V, Martinez-Velazquez LA, Zhang X, Calvo AC, et al. Bidirectional thermotaxis in Caenorhabditis elegans is mediated by distinct sensorimotor strategies driven by the AFD thermosensory neurons. Proc Natl Acad Sci U S A. 2014;111(7):2776–2781. doi: 10.1073/pnas.1315205111 24550307
51. Ohnishi N, Kuhara A, Nakamura F, Okochi Y, Mori I. Bidirectional regulation of thermotaxis by glutamate transmissions in Caenorhabditis elegans. Embo j. 2011;30(7):1376–1388. doi: 10.1038/emboj.2011.13 21304490
52. Perkins LA, Hedgecock EM, Thomson JN, Culotti JG. Mutant sensory cilia in the nematode Caenorhabditis elegans. Dev Biol. 1986;117(2):456–487. doi: 10.1016/0012-1606(86)90314-3 2428682
53. Biron D, Wasserman S, Thomas JH, Samuel AD, Sengupta P. An olfactory neuron responds stochastically to temperature and modulates Caenorhabditis elegans thermotactic behavior. Proc Natl Acad Sci U S A. 2008;105(31):11002–11007. doi: 10.1073/pnas.0805004105 18667708
54. Kuhara A, Okumura M, Kimata T, Tanizawa Y, Takano R, Kimura KD, et al. Temperature sensing by an olfactory neuron in a circuit controlling behavior of C. elegans. Science. 2008;320(5877):803–807. doi: 10.1126/science.1148922 18403676
55. Shao Z, Watanabe S, Christensen R, Jorgensen EM, Colon-Ramos DA. Synapse location during growth depends on glia location. Cell. 2013;154(2):337–350. doi: 10.1016/j.cell.2013.06.028 23870123
56. Fan J, Ji T, Wang K, Huang J, Wang M, Manning L, et al. A muscle-epidermis-glia signaling axis sustains synaptic specificity during allometric growth in Caenorhabditis elegans. Elife. 2020;9. doi: 10.7554/eLife.55890 32255430
57. Maruyama IN, Brenner S. A phorbol ester/diacylglycerol-binding protein encoded by the unc-13 gene of Caenorhabditis elegans. Proc Natl Acad Sci U S A. 1991;88(13):5729–5733. doi: 10.1073/pnas.88.13.5729 2062851
58. Lee RY, Sawin ER, Chalfie M, Horvitz HR, Avery L. EAT-4, a homolog of a mammalian sodium-dependent inorganic phosphate cotransporter, is necessary for glutamatergic neurotransmission in caenorhabditis elegans. J Neurosci. 1999;19(1):159–167. doi: 10.1523/JNEUROSCI.19-01-00159.1999 9870947
59. McIntire SL, Reimer RJ, Schuske K, Edwards RH, Jorgensen EM. Identification and characterization of the vesicular GABA transporter. Nature. 1997;389(6653):870–876. doi: 10.1038/39908 9349821
60. Alfonso A, Grundahl K, Duerr JS, Han HP, Rand JB. The Caenorhabditis elegans unc-17 gene: a putative vesicular acetylcholine transporter. Science. 1993;261(5121):617–619. doi: 10.1126/science.8342028 8342028
61. Lints R, Emmons SW. Patterning of dopaminergic neurotransmitter identity among Caenorhabditis elegans ray sensory neurons by a TGFbeta family signaling pathway and a Hox gene. Development. 1999;126(24):5819–5831. 10572056
62. Thompson O, Edgley M, Strasbourger P, Flibotte S, Ewing B, Adair R, et al. The million mutation project: a new approach to genetics in Caenorhabditis elegans. Genome Res. 2013;23(10):1749–1762. doi: 10.1101/gr.157651.113 23800452
63. Nonet ML, Staunton JE, Kilgard MP, Fergestad T, Hartwieg E, Horvitz HR, et al. Caenorhabditis elegans rab-3 mutant synapses exhibit impaired function and are partially depleted of vesicles. J Neurosci. 1997;17(21):8061–8073. doi: 10.1523/JNEUROSCI.17-21-08061.1997 9334382
64. Serrano-Saiz E, Poole RJ, Felton T, Zhang F, De La Cruz ED, Hobert O. Modular control of glutamatergic neuronal identity in C. elegans by distinct homeodomain proteins. Cell. 2013;155(3):659–673. doi: 10.1016/j.cell.2013.09.052 24243022
65. Egan CR, Chung MA, Allen FL, Heschl MF, Van Buskirk CL, McGhee JD. A gut-to-pharynx/tail switch in embryonic expression of the Caenorhabditis elegans ges-1 gene centers on two GATA sequences. Dev Biol. 1995;170(2):397–419. doi: 10.1006/dbio.1995.1225 7649372
66. Fox RM, Watson JD, Stetina SEV, Mcdermott J, Brodigan TM, Fukushige T, et al. The embryonic muscle transcriptome of Caenorhabditis elegans. Genome Biology. 2007;8(9):R188. doi: 10.1186/gb-2007-8-9-r188 17848203
67. McMahon L, Muriel JM, Roberts B, Quinn M, Johnstone IL. Two sets of interacting collagens form functionally distinct substructures within a Caenorhabditis elegans extracellular matrix. Mol Biol Cell. 2003;14(4):1366–1378. doi: 10.1091/mbc.e02-08-0479 12686594
68. McMiller TL, Johnson CM. Molecular characterization of HLH-17, a C. elegans bHLH protein required for normal larval development. Gene. 2005;356 : 1–10. doi: 10.1016/j.gene.2005.05.003 16014321
69. Wenick AS, Hobert O. Genomic cis-regulatory architecture and trans-acting regulators of a single interneuron-specific gene battery in C. elegans. Dev Cell. 2004;6(6):757–770. doi: 10.1016/j.devcel.2004.05.004 15177025
70. Kim K, Li C. Expression and regulation of an FMRFamide-related neuropeptide gene family in Caenorhabditis elegans. J Comp Neurol. 2004;475(4):540–550. doi: 10.1002/cne.20189 15236235
71. Yu S, Avery L, Baude E, Garbers DL. Guanylyl cyclase expression in specific sensory neurons: a new family of chemosensory receptors. Proc Natl Acad Sci U S A. 1997;94(7):3384–3387. doi: 10.1073/pnas.94.7.3384 9096403
72. Troemel ER, Sagasti A, Bargmann CI. Lateral signaling mediated by axon contact and calcium entry regulates asymmetric odorant receptor expression in C. elegans. Cell. 1999;99(4):387–398. doi: 10.1016/s0092-8674(00)81525-1 10571181
73. Brockie PJ, Madsen DM, Zheng Y, Mellem J, Maricq AV. Differential expression of glutamate receptor subunits in the nervous system of Caenorhabditis elegans and their regulation by the homeodomain protein UNC-42. J Neurosci. 2001;21(5):1510–1522. doi: 10.1523/JNEUROSCI.21-05-01510.2001 11222641
74. Dwyer ND, Troemel ER, Sengupta P, Bargmann CI. Odorant receptor localization to olfactory cilia is mediated by ODR-4, a novel membrane-associated protein. Cell. 1998;93(3):455–466. doi: 10.1016/s0092-8674(00)81173-3 9590179
75. Lee BH, Liu J, Wong D, Srinivasan S, Ashrafi K. Hyperactive neuroendocrine secretion causes size, feeding, and metabolic defects of C. elegans Bardet-Biedl syndrome mutants. PLoS Biol. 2011;9(12):e1001219. doi: 10.1371/journal.pbio.1001219 22180729
76. Macosko EZ, Navin P, Feinberg EH, Chalasani SH, Butcher RA, Jon C, et al. A hub-and-spoke circuit drives pheromone attraction and social behaviour in C. elegans. Nature. 2009;458(7242):1171–1175. doi: 10.1038/nature07886 19349961
77. Miyabayashi T, Palfreyman MT, Sluder AE, Slack F, Sengupta P. Expression and function of members of a divergent nuclear receptor family in Caenorhabditis elegans. Developmental Biology. 1999;215(2):314. doi: 10.1006/dbio.1999.9470 10545240
78. Troemel ER, Chou JH, Dwyer ND, Colbert HA, Bargmann CI. Divergent seven transmembrane receptors are candidate chemosensory receptors in C. elegans. Cell. 1995;83(2):207–218. doi: 10.1016/0092-8674(95)90162-0 7585938
79. Daniels RW, Collins CA, Gelfand MV, Dant J, Brooks ES, Krantz DE, et al. Increased expression of the Drosophila vesicular glutamate transporter leads to excess glutamate release and a compensatory decrease in quantal content. J Neurosci. 2004;24(46):10466–10474. doi: 10.1523/JNEUROSCI.3001-04.2004 15548661
80. Daniels RW, Miller BR, DiAntonio A. Increased vesicular glutamate transporter expression causes excitotoxic neurodegeneration. Neurobiol Dis. 2011;41(2):415–420. doi: 10.1016/j.nbd.2010.10.009 20951206
81. Wilson NR, Kang J, Hueske EV, Leung T, Varoqui H, Murnick JG, et al. Presynaptic regulation of quantal size by the vesicular glutamate transporter VGLUT1. J Neurosci. 2005;25(26):6221–6234. doi: 10.1523/JNEUROSCI.3003-04.2005 15987952
82. Wojcik SM, Rhee JS, Herzog E, Sigler A, Jahn R, Takamori S, et al. An essential role for vesicular glutamate transporter 1 (VGLUT1) in postnatal development and control of quantal size. Proc Natl Acad Sci U S A. 2004;101(18):7158–7163. doi: 10.1073/pnas.0401764101 15103023
83. Chelur DS, Martin C. Targeted cell killing by reconstituted caspases. Proceedings of the National Academy of Sciences of the United States of America. 2007;104(7):2283–2288. doi: 10.1073/pnas.0610877104 17283333
84. Brockie PJ, Maricq AV. Ionotropic glutamate receptors in Caenorhabditis elegans. Neuro-Signals. 2003;12(3):108–125. doi: 10.1159/000072159 12904685
85. Brockie PJ, Maricq AV. Ionotropic glutamate receptors: genetics, behavior and electrophysiology. WormBook. 2006 : 1–16.
86. Dillon J, Hopper NA, Holden-Dye L, O'Connor V. Molecular characterization of the metabotropic glutamate receptor family in Caenorhabditis elegans. Biochem Soc Trans. 2006;34(Pt 5):942–948. doi: 10.1042/BST0340942 17052233
87. Horoszok L, Raymond V, Sattelle DB, Wolstenholme AJ. GLC-3: a novel fipronil and BIDN-sensitive, but picrotoxinin-insensitive, L-glutamate-gated chloride channel subunit from Caenorhabditis elegans. Br J Pharmacol. 2001;132(6):1247–1254. doi: 10.1038/sj.bjp.0703937 11250875
88. Dent JA, Davis MW, Avery L. avr-15 encodes a chloride channel subunit that mediates inhibitory glutamatergic neurotransmission and ivermectin sensitivity in Caenorhabditis elegans. Embo j. 1997;16(19):5867–5879. doi: 10.1093/emboj/16.19.5867 9312045
89. Petersen CI, McFarland TR, Stepanovic SZ, Yang P, Reiner DJ, Hayashi K, et al. In vivo identification of genes that modify ether-a-go-go-related gene activity in Caenorhabditis elegans may also affect human cardiac arrhythmia. Proc Natl Acad Sci U S A. 2004;101(32):11773–11778. doi: 10.1073/pnas.0306005101 15280551
90. Collins KM, Koelle MR. Postsynaptic ERG potassium channels limit muscle excitability to allow distinct egg-laying behavior states in Caenorhabditis elegans. J Neurosci. 2013;33(2):761–775. doi: 10.1523/JNEUROSCI.3896-12.2013 23303953
91. Jin X, Pokala N, Bargmann Cornelia I. Distinct Circuits for the Formation and Retrieval of an Imprinted Olfactory Memory. Cell. 2016;164(4):632–643. doi: 10.1016/j.cell.2016.01.007 26871629
92. Bai X, Li K, Yao L, Kang XL, Cai SQ. A forward genetic screen identifies chaperone CNX-1 as a conserved biogenesis regulator of ERG K(+) channels. The Journal of general physiology. 2018;150(8):1189–1201. doi: 10.1085/jgp.201812025 29941431
93. Hawk JD, Calvo AC, Liu P, Almoril-Porras A, Aljobeh A, Torruella-Suárez ML, et al. Integration of Plasticity Mechanisms within a Single Sensory Neuron of C. elegans Actuates a Memory. Neuron. 2018;97(2):356–367.e354. doi: 10.1016/j.neuron.2017.12.027 29307713
94. Cook SJ, Jarrell TA, Brittin CA, Wang Y, Bloniarz AE, Yakovlev MA, et al. Whole-animal connectomes of both Caenorhabditis elegans sexes. Nature. 2019;571(7763):63–71. doi: 10.1038/s41586-019-1352-7 31270481
95. Witvliet D, Mulcahy B, Mitchell JK, Meirovitch Y, Berger DR, Wu Y, et al. Connectomes across development reveal principles of brain maturation in C. elegans. 2020 : 2020.2004.2030.066209.
96. Fatt HV, Dougherty EC. Genetic Control of Differential Heat Tolerance in Two Strains of the Nematode Caenorhabditis elegans. Science. 1963;141(3577):266–267. doi: 10.1126/science.141.3577.266 17841565
97. Miesenböck G, De Angelis DA, Rothman JE. Visualizing secretion and synaptic transmission with pH-sensitive green fluorescent proteins. Nature. 1998;394(6689):192–195. doi: 10.1038/28190 9671304
98. Shi SH, Hayashi Y, Petralia RS, Zaman SH, Wenthold RJ, Svoboda K, et al. Rapid spine delivery and redistribution of AMPA receptors after synaptic NMDA receptor activation. Science. 1999;284(5421):1811–1816. doi: 10.1126/science.284.5421.1811 10364548
99. Wong WT, Wong RO. Changing specificity of neurotransmitter regulation of rapid dendritic remodeling during synaptogenesis. Nat Neurosci. 2001;4(4):351–352. doi: 10.1038/85987 11276221
100. Zheng JQ, Felder M, Connor JA, Poo MM. Turning of nerve growth cones induced by neurotransmitters. Nature. 1994;368(6467):140–144. doi: 10.1038/368140a0 8139655
101. Huang ZJ. Activity-dependent development of inhibitory synapses and innervation pattern: role of GABA signalling and beyond. J Physiol. 2009;587(Pt 9):1881–1888. doi: 10.1113/jphysiol.2008.168211 19188247
102. Oh WC, Smith KR. Activity-dependent development of GABAergic synapses. Brain Res. 2019;1707 : 18–26. doi: 10.1016/j.brainres.2018.11.014 30439352
103. Oh WC, Lutzu S, Castillo PE, Kwon HB. De novo synaptogenesis induced by GABA in the developing mouse cortex. Science. 2016;353(6303):1037–1040. doi: 10.1126/science.aaf5206 27516412
104. Gibson CL, Balbona JT, Niedzwiecki A, Rodriguez P, Nguyen KCQ, Hall DH, et al. Glial loss of the metallo β-lactamase domain containing protein, SWIP-10, induces age - and glutamate-signaling dependent, dopamine neuron degeneration. PLoS Genet. 2018;14(3):e1007269. doi: 10.1371/journal.pgen.1007269 29590100
105. Kalivas PW. The glutamate homeostasis hypothesis of addiction. Nat Rev Neurosci. 2009;10(8):561–572. doi: 10.1038/nrn2515 19571793
106. Mitchell SJ, Silver RA. Glutamate spillover suppresses inhibition by activating presynaptic mGluRs. Nature. 2000;404(6777):498–502. doi: 10.1038/35006649 10761918
107. Katz M, Corson F, Keil W, Singhal A, Bae A, Lu Y, et al. Glutamate spillover in C. elegans triggers repetitive behavior through presynaptic activation of MGL-2/mGluR5. Nat Commun. 2019;10(1):1882. doi: 10.1038/s41467-019-09581-4 31015396
108. Hardaway JA, Sturgeon SM, Snarrenberg CL, Li Z, Xu XZ, Bermingham DP, et al. Glial Expression of the Caenorhabditis elegans Gene swip-10 Supports Glutamate Dependent Control of Extrasynaptic Dopamine Signaling. J Neurosci. 2015;35(25):9409–9423. doi: 10.1523/JNEUROSCI.0800-15.2015 26109664
109. Isaacson JS, Solís JM, Nicoll RA. Local and diffuse synaptic actions of GABA in the hippocampus. Neuron. 1993;10(2):165–175. doi: 10.1016/0896-6273(93)90308-e 7679913
110. Isaacson JS. Spillover in the spotlight. Curr Biol. 2000;10(13):R475–477. doi: 10.1016/s0960-9822(00)00551-0 10898970
111. Manz KM, Baxley AG, Zurawski Z, Hamm HE, Grueter BA. Heterosynaptic GABA(B) Receptor Function within Feedforward Microcircuits Gates Glutamatergic Transmission in the Nucleus Accumbens Core. J Neurosci. 2019;39(47):9277–9293. doi: 10.1523/JNEUROSCI.1395-19.2019 31578230
112. Sanchez-Vives MV, Barbero-Castillo A, Perez-Zabalza M, Reig R. GABA(B) receptors: modulation of thalamocortical dynamics and synaptic plasticity. Neuroscience. 2020. doi: 10.1016/j.neuroscience.2020.03.011 32194227
113. Vassilatis DK, Arena JP, Plasterk RH, Wilkinson HA, Schaeffer JM, Cully DF, et al. Genetic and biochemical evidence for a novel avermectin-sensitive chloride channel in Caenorhabditis elegans. Isolation and characterization. J Biol Chem. 1997;272(52):33167–33174. doi: 10.1074/jbc.272.52.33167 9407104
114. Wolstenholme AJ. Glutamate-gated chloride channels. J Biol Chem. 2012;287(48):40232–40238. doi: 10.1074/jbc.R112.406280 23038250
115. Vassilatis DK, Elliston KO, Paress PS, Hamelin M, Arena JP, Schaeffer JM, et al. Evolutionary relationship of the ligand-gated ion channels and the avermectin-sensitive, glutamate-gated chloride channels. Journal of molecular evolution. 1997;44(5):501–508. doi: 10.1007/pl00006174 9115174
116. Avila A, Vidal PM, Dear TN, Harvey RJ, Rigo JM, Nguyen L. Glycine receptor alpha2 subunit activation promotes cortical interneuron migration. Cell Rep. 2013;4(4):738–750. doi: 10.1016/j.celrep.2013.07.016 23954789
117. Kirsch J, Betz H. Glycine-receptor activation is required for receptor clustering in spinal neurons. Nature. 1998;392(6677):717–720. doi: 10.1038/33694 9565032
118. Lynch JW, Zhang Y, Talwar S, Estrada-Mondragon A. Glycine Receptor Drug Discovery. Adv Pharmacol. 2017;79 : 225–253. doi: 10.1016/bs.apha.2017.01.003 28528670
119. Beverly M, Anbil S, Sengupta P. Degeneracy and neuromodulation among thermosensory neurons contribute to robust thermosensory behaviors in Caenorhabditis elegans. J Neurosci. 2011;31(32):11718–11727. doi: 10.1523/JNEUROSCI.1098-11.2011 21832201
120. Edwards MJ. Review: Hyperthermia and fever during pregnancy. Birth defects research Part A, Clinical and molecular teratology. 2006;76(7):507–516. doi: 10.1002/bdra.20277 16933304
121. Wang X, Amei A, de Belle JS, Roberts SP. Environmental effects on Drosophila brain development and learning. The Journal of experimental biology. 2018;221(Pt 1). doi: 10.1242/jeb.169375 29061687
122. Mellert DJ, Williamson WR, Shirangi TR, Card GM, Truman JW. Genetic and Environmental Control of Neurodevelopmental Robustness in Drosophila. PLoS One. 2016;11(5):e0155957. doi: 10.1371/journal.pone.0155957 27223118
123. Zhang B, Gong J, Zhang W, Xiao R, Liu J, Xu XZS. Brain-gut communications via distinct neuroendocrine signals bidirectionally regulate longevity in C. elegans. Genes Dev. 2018;32(3–4):258–270. doi: 10.1101/gad.309625.117 29491136
124. Kotera I, Tran NA, Fu D, Kim JH, Byrne Rodgers J, Ryu WS. Pan-neuronal screening in Caenorhabditis elegans reveals asymmetric dynamics of AWC neurons is critical for thermal avoidance behavior. Elife. 2016;5. doi: 10.7554/eLife.19021 27849153
125. Samuel AD, Silva RA, Murthy VN. Synaptic activity of the AFD neuron in Caenorhabditis elegans correlates with thermotactic memory. J Neurosci. 2003;23(2):373–376. doi: 10.1523/JNEUROSCI.23-02-00373.2003 12533596
126. Brenner S. The genetics of Caenorhabditis elegans. Genetics. 1974;77(1):71–94. 4366476
127. Gibson DG, Young L, Chuang RY, Venter JC, Hutchison CA, 3rd, Smith HO. Enzymatic assembly of DNA molecules up to several hundred kilobases. Nat Methods. 2009;6(5):343–345. doi: 10.1038/nmeth.1318 19363495
128. Mello C, Fire A. DNA transformation. Methods Cell Biol. 1995;48 : 451–482. 8531738
129. Ventimiglia D, Bargmann CI. Diverse modes of synaptic signaling, regulation, and plasticity distinguish two classes of C. elegans glutamatergic neurons. Elife. 2017;6. doi: 10.7554/eLife.31234 29160768
130. Saalfeld S, Cardona A, Hartenstein V, Tomancak P. CATMAID: collaborative annotation toolkit for massive amounts of image data. Bioinformatics (Oxford, England). 2009;25(15):1984–1986. doi: 10.1093/bioinformatics/btp266 19376822
131. Chandler-Brown D, Choi H, Park S, Ocampo BR, Chen S, Le A, et al. Sorbitol treatment extends lifespan and induces the osmotic stress response in Caenorhabditis elegans. Frontiers in genetics. 2015;6 : 316. doi: 10.3389/fgene.2015.00316 26579191
132. Lee SS, Lee RY, Fraser AG, Kamath RS, Ahringer J, Ruvkun G. A systematic RNAi screen identifies a critical role for mitochondria in C. elegans longevity. Nat Genet. 2003;33(1):40–48. doi: 10.1038/ng1056 12447374
133. Shao J, Zhang X, Cheng H, Yue X, Zou W, Kang L. Serotonergic neuron ADF modulates avoidance behaviors by inhibiting sensory neurons in C. elegans. Pflugers Archiv: European journal of physiology. 2019;471(2):357–363. doi: 10.1007/s00424-018-2202-4 30206705
Článek vyšel v časopisePLOS Genetics
Nejčtenější tento týden
2021 Číslo 1- Využití diklofenaku ve formě gelu v terapii seboroické keratózy
- Autismus u dětí matek užívajících SSRI v těhotenství?
- „Šílený med“: požitek, zbraň i léčivo tradiční medicíny
- Budoucnost guaifenesinu jako OTC myorelaxans
- Není statin jako statin aneb praktický přehled rozdílů v jednotlivých molekulách
-
Všechny články tohoto čísla
- MED19 alters AR occupancy and gene expression in prostate cancer cells, driving MAOA expression and growth under low androgen
- Factors enforcing the species boundary between the human pathogens Cryptococcus neoformans and Cryptococcus deneoformans
- The clarifying role of time series data in the population genetics of HIV
- Impaired tumor immune response in metastatic tumors is a selective pressure for neutral evolution in CRC cases
- Population structure of indigenous inhabitants of Arabia
- Identifying drug targets for neurological and psychiatric disease via genetics and the brain transcriptome
- Human genome diversity data reveal that L564P is the predominant TPC2 variant and a prerequisite for the blond hair associated M484L gain-of-function effect
- Resistance to pirimiphos-methyl in West African Anopheles is spreading via duplication and introgression of the Ace1 locus
- A rare coding mutation in the MAST2 gene causes venous thrombosis in a French family with unexplained thrombophilia: The Breizh MAST2 Arg89Gln variant
- Genome-scale CRISPR screening for modifiers of cellular LDL uptake
- Htt is a repressor of Abl activity required for APP-induced axonal growth
- Temperature regulates synaptic subcellular specificity mediated by inhibitory glutamate signaling
- Epithelial cell-turnover ensures robust coordination of tissue growth in Drosophila ribosomal protein mutants
- Kinetochore-independent mechanisms of sister chromosome separation
- Consequences of adaptation of TAL effectors on host susceptibility to Xanthomonas
- Regulating the expression of gene drives is key to increasing their invasive potential and the mitigation of resistance
- Ablation of DNA-methyltransferase 3A in skeletal muscle does not affect energy metabolism or exercise capacity
- Correction: Unified inference of missense variant effects and gene constraints in the human genome
- PLOS Genetics
- Archiv čísel
- Aktuální číslo
- Informace o časopisu
Nejčtenější v tomto čísle- Identifying drug targets for neurological and psychiatric disease via genetics and the brain transcriptome
- A rare coding mutation in the MAST2 gene causes venous thrombosis in a French family with unexplained thrombophilia: The Breizh MAST2 Arg89Gln variant
- Impaired tumor immune response in metastatic tumors is a selective pressure for neutral evolution in CRC cases
- Temperature regulates synaptic subcellular specificity mediated by inhibitory glutamate signaling
Přihlášení#ADS_BOTTOM_SCRIPTS#Zapomenuté hesloZadejte e-mailovou adresu, se kterou jste vytvářel(a) účet, budou Vám na ni zaslány informace k nastavení nového hesla.
- Vzdělávání